1. INTRODUCTION
Forests account for approximately 64% (6,335,000 ha) of the national territory of Korea, of which 36.9% (2,339,000 ha) is occupied by coniferous forest that cover a larger proportion of the land than broadleaf forest [32.0% (2,029,000 ha)] (Kong, 2004). Based on species, coniferous forest occupies a vast amount of the land [43.7% (403971300 m3, 172.7 m3/ha)] (Korea Forest Service, Basic Statistics of Forests, 2016). Among coniferous trees, cypress, pine, pine nut, and Japanese larch are used for timber (Korea Forest Service, Basic Statistics of Forests, 2016). Since cypress (Chamaecyparis obtusa Sieb. et Zucc.) was first introduced from Japan in 1904, it has been planted in the southern area as an economic species, and it has continuously been cultivated by national projects to develop more green areas (Lee et al., 2014). Cypress timber is considered high-quality wood with a unique scent; thus, it is widely used in architecture and manufacture of high-end furniture. Cypress extract contains various substances, of which bioactive substances are well known. All parts of pine (Pinus densiflora Sieb. et Zucc.), an evergreen softwood species, are very useful because its leaf, conifer cone, and pine resin are widely used. Pine are also used in home remedies for the treatment of diseases such as neuralgia, diabetes, and hypertension (Cho et al., 2009). Among other local tree species, pine is particularly closely related to the local community. Indeed, it has been regarded as a vital tree species in terms of cultural value.
Pine nut (P. koraiensis Sieb. et Zucc.) offers double benefits because it provides timber and edible seeds. Because of its robust tolerance to cold and resistance against damages caused by blights and harmful insects, its plantation has long been recommended by the government considering its potential as a long-term source of timber since the 1960s. Japanese larch (Larix kaempferi Lamb.) was introduced from Japan in the 1910s, it has been planted across the country, because of its rapid growth, and is used for artificial forests and is widely used in the manufacture of wooden products and architectural materials (Kang et al., 2016; Han et al., 2017). Korea’s appreciation toward forests is deepening, and the demand for the use of these forests is diversifying. Pine, pine nut, and Japanese larch are the tree species that are harvested across the country on a large scale. Thus, research to enhance the use of locally accumulated resources and their byproducts following woodcutting is currently required.
With many synthetic drugs and chemical preservatives being identified to be hazardous, natural products are drawing considerable attention. Various studies have been conducted on the use of tree extracts including essential oils for the development of antioxidants (Jung et al., 2017; Kim et al., 2017), anti-inflammatory drugs (Min et al., 2017; Yang et al., 2017), antifungal agents (Rho et al., 2014; Kim et al., 2013), anticomplements (Li et al., 2018), and biofilm inhibitors (Ham and Kim, 2018). Essential oils, secondary metabolites of plants, have various biological activities, among which soothing effect and robustness are well known. In particular, essential oils are often used in aroma therapy for their known benefits to restore mental and physical balance as well as to maintain homeostasis. These properties are induced by the substances present in them such as ketone, terpene, and phenolic ether (Carvalho-Freitas and Costa, 2002). A study showed the antifungal effect of an essential oil extracted from leaves of coniferous trees such as pine, pine nut, cypress, and fir tree (Hong et al., 2004; Kim et al., 2016). Ibrahim et al. evaluated the anti-inflammatory and scar-healing effects of an essential oil extracted from the cones of six types of coniferous trees belonging to the Pinaceae family. Plants belonging to an identical family and genus showed different degrees of anti-inflammatory and scar-healing effects. Cedrus libani and Abies cilicica subsp. Cilicica have anti-inflammatory effects. Further, the herbicidal effect of essential oils extracted from the leaves of locally bred pine, pine nut, Japanese larch, and Khingan fir was studied (Yun et al., 2013). As a result of verifying the in vitro herbicidal activity of essential oils extracted from four coniferous tree species on germination, these essential oils (except that derived from pine leaf) showed herbicidal activity. The different degrees of herbicidal activity because of the different substances present in these essential oils and their concentrations affects cytotoxicity and the cell cycle. The importance of these tree species and their concentration in the field where they can be practically used is high (Ahn et al., 2018).
There are varied ongoing studies on the bioactivity of essential oils extracted from coniferous tree species, but limited to leaves and the studies on the bioactivity of essential oils extracted from the wood are insufficient. Therefore, this study aimed to compare and analyze the anti-inflammatory activity of essential oils extracted from the wood of four coniferous tree species including cypress (C. obtusa), pine (P. densiflora), pine nut (P. koraiensis), and Japanese larch (L. kaempferi), all of which are typical local tree species used for timber. This study also aimed to verify the potential use of essential oils extracted from coniferous wood for improving or preventing allergic diseases.
2. MATERIALS and METHODS
Cypress (C. obtusa Sieb. et Zucc.) and pine (P. densiflora Sieb. et Zucc.) were purchased through the Gapeyong National Forestry Cooperative Federation, which were obtained from the South Sea in December of 2014. Japanese larche (L. kaempferi Sieb. et Zucc.) was cut in Pyeongchang in December 2015, whereas pine nut (P. koraiensis Sieb. et Zucc.) was cut in Gapyeong in January 2016.
The wood of cypress, pine, pine nut, and Japanese larch were grinded to extract essential oils through hydrodistillation. One kg of a sample was placed in a 10 L round-bottomed flask; then, 6 L distilled water was poured and the mixture was heated to 105°C. Vaporized substances formed an extract, which was cooled to obtain essential oils. Extraction continued until no more essential oil was obtained, which lasted for approximately 7 h. The extracted essential oil was processed to remove moisture using anhydrous Na2SO4(SAMCHUN,98.5). The final product was stored in a refrigerator until analysis.
The yield rate of essential oils was calculated using the following equation.
To assess the level of anti-inflammatory effect of essential oils extracted from the wood of the four coniferous tree species, RBL-2H3 mast cells (CRL- 22256™; American Type Culture Collection, Manassas, Manassas, VA, USA) were purchased in lots. These cells were cultured in Dulbecco’s modified Eagle’s medium (Gibco) containing 10% fetal bovine serum (Gibco), 1% penicillin/streptomycin (Gibco), and 0.4 μL/mL mycoplasma guard in an incubator (Panasonic, MCO-19AIC) at 37°C (5% CO2).
The essential oils extracted from the wood of the four coniferous tree species were qualitatively analyzed using GC/MS (Trace 1310/ISQ-LT, ThermoScientific, USA). The Tr-5MS capillary column (30 m × 0.25 mm × 0.25 μm; ThermoScientific, USA) was used, and helium (1 mL/min, 25 psi) was used as the carrier gas. Sample inlet was maintained at 250°C. Further, an oven was maintained at 40°C for 3 min, after which the temperature was increased by 3°C until it reached 200°C and then was raised by 15°C until it reached 340°C for 10 min. FID and mass spectrum of detected chemicals were recorded. FID was maintained at 280°C, and the flow rate for helium was 40 mL/min. The temperatures of the interface of a mass spectrometer and ion source were maintained at 280°C and 250°C, respectively.
The analyzed substances in essential oils were selected based on the value showing the highest spectral matching when the S/N ratio reached ≥100 in total-ion chromatography at peaks with NIST library search program (ver.11). Furthermore, to confirm the chemical composition of essential oils, the Kovats retention index was calculated using n-alkanes (C8–C20, Sigma-Aldrich).
To assess the cytotoxicity of essential oils toward RBL-2H3 mast cells, the MTT assay was performed. A 200 μL culture medium was used, and cells were seeded in a 96-well plate at a density of 8 × 103 cells/well. Then, the plate was incubated in an incubator at 37°C with 5% CO2 for 1 day. The MTT reagent (Sigma, Cat.#. 11465007001) was added to the cells that were exposed to the essential oils at concentrations of 10−7%–10−5%. They were again placed in the incubator at 37°C for 6 h. The growth culture medium and MTT reagent were removed, and the mixture was washed with Dulbecco’s phosphate-buffered saline (Gibco). Next, 100 μL dimethyl sulfoxide (Sigma) was added to each well, and the mixture was stored at room temperature for 10 min. The optical density of the cells was determined at a wavelength of 540 nm using a spectrophotometer.
RBL-2H3 mast cells were seeded into a 6-well plate at a density of 3 × 105 cells/well, and the plate was incubated for 24 h with 1 μg/mL lipopolysaccharide (LPS). Then, the essential oils were processed. After 24 h cultivation, 500 μL TRIzol reagent (Invitrogen Life Technologies) was added to each well of the 6-well plate, and the cells were dissolved and moved into tubes. Next, 100 μL chloroform was added, and the tubes were centrifuged at 14,000 rpm for 10 min. Further, 150 μL of the obtained supernatant was collected, and isopropanol was added in the same amount. RNA was condensed at −20°C for 24 h. After centrifuging the mixture at 14,000 rpm at 4°C for 10 min, the supernatant was removed, 200 μL DEPC/EtOH was added, the mixture was centrifuged, and then the entire supernatant was removed. Next, 20 μL DEPC/DW was added, the mixture was stored at 55°C for 5 min to increase the temperature, and then RNA concentration was measured at a wavelength of 260 nm using a microplate spectrophotometer (Epoch, model Take 3; BioTek Inc., Winooski, VT, USA). cDNA was synthesized from mRNA using a quantitative method; then, real-time PCR was performed using a real-time PCR system (Applied Biosystems, Foster, CA, USA). The sequences of the oligonucleotide primers used are shown in Table 1. The relative values for each wood essential oil were determined using the RQ software (version 1.3, Applied Biosystems).
| Gene | Primer sequence (5`-3`) |
|---|---|
| IL-4 | F : tgatgtacctccgtgcttga |
| R : aggacatggaagtgcaggac | |
| IL-13 | F : ctggaatccctgaccaacat |
| R : ccatagcggaaaagttgctt | |
| β-actin | F : ttctacaatgagctgcgtgtg |
| R : accagaggcatacagggaca |
To analyze the changes in the rate of β-hexosaminidase release by the essential oils in LPS-induced RBL-2H3 mast cells, cells were seeded into a 96-well plate at a density of 8 × 103 cells/well and then stimulated with DNP-specific IgE (800 ng/mL, Sigma, USA). After removing the culture medium, the mixture was washed twice with Tyrodes’ solution [119 mM NaCl, 4.74 mM KCl, 2.5 mM CaCl2, 1.19 mM MgSO4, 10 mM HEPES, 5 mM glucose, 0.1% (w/v) BSA; pH 7.3] and cultivated for 15 min; a mixture of the essential oils and DNP/BSA was incubated for 1 h. Then, 50 μL supernatant was transferred to a tube, added with 200 μL of 1 mM P-nitrophenyl-Nacetyl- β-D-glucosaminide, and cultured at 37°C for 1 h. To terminate the reaction, 0.05 M sodium bicarbonate buffer was added, and optical density was measured at a wavelength of 405 nm.
3. RESULTS and DISCUSSION
The yield rate of the essential oils extracted from the wood of the four coniferous tree species was the highest for cypress (0.86%) and pine (0.75%) followed by pine nut (0.25%) and Japanese larch (0.06%).
The chemical composition of these essential oils is summarized in Table 2. In brief, the essential oil extracted from cypress wood contained 23.79% monoterpene, 76.07% sesquiterpene, and 0.13% other substances. The essential oil extracted from pine wood contained 81.49% monoterpene, 17.75% sesquiterpene, 0.55% diterpene, and 0.20% other substances. Further, the essential oil extracted from pine nut wood contained 67.90% monoterpene, 21.93% sesquiterpene 8.08% diterpene, and 2.09% other substances. Lastly, the essential oil extracted from Japanese larch contained 34.82% monoterpene, 29.70% sesquiterpene, and 35.48% diterpene, indicating that their proportion is similar. The main substances in cypress included α -cadinol (19.25%), τ-muurolol (14.20%), α-pinene (13.74%), τ-cadinol (9.84%), δ-cadinene (7.37%), and γ-cadinene (6.52%), whereas those in pine included α -pinene (47.16%), longifolene (14.31%), β-phellandrene (11.78%), and β-pinene (11.02%). The main substances in pine nut included α-pinene (28.22%), longifolene (13.49%), β-pinene (10.79%), cembrene (8.08%), and α-terpineol (7.63%), whereas those in Japanese larch included geranyl linalool (23.58%), α-pinene (18.57%), α-cadinol (6.24%), and cembrene (6.12%). Among the detected vaporizing substances, α-pinene, β-pinene, limonene, fenchol, borneol, 4-terpineol, α-terpineol, and δ-cadinene were detected in all essential oils.
To determine the influence of essential oils extracted from the wood of the four coniferous tree species on the survival and reproduction of RBL-2H3 mast cells, these essential oils were processed at concentrations of 10−7%–10−5%, and then MTT assay was performed. Cytotoxicity results are presented in Fig. 1.
When the essential oils were compared with the oils of the vehicle group (VE), cytotoxicity was not observed at concentrations of 10−7%–10−5%. Accordingly, further evaluation confirmed the anti-inflammatory effect of all essential oils at a concentration of 10−7%.
RBL-2H3 mast cells, derived from basophils, play crucial roles in anti-inflammatory activity together with other mast cells. They are known to be a useful model for the study of the effects of drugs triggering the release of IL-4 and IL-13, which cause inflammation by various external stimulation and regulate the immune system (Prussin and Metcalfe, 2003; Kindt et al., 2007). IL-4 and IL-13 released following mast cell activity increases Th2 reactions; and subsequently Th2 induces IgE production in B cells and thereby induces an allergic reaction. Because IL-13 shares its receptor with IL-4, it functions similar to IL-4; therefore, by examining the changes in their levels, anti-inflammatory effect can be investigated (Yoon and Pyo, 2012; Hershey et al., 1997).
The following groups were formed: VE, negative control (NC; group treated with LPS), positive control (PC; group treated with dexamethasone in LPS-induced RBL-2H3 mast cells), and treatment group (treatment with essential oils). The results of relative IL-4 and IL-13 gene expression were obtained based on the type of tree species.
As shown in Fig. 2(a), when LPS that induced an inflammatory reaction was incubated with RBL-2H3 mast cells, the relative gene expression of IL-4 increased by 6.6 times compared with that in VE. In PC, an inflammatory reaction was induced and the relative gene expression of IL-4 decreased by 82.8% compared with that in NC. In the treatment group, high anti-inflammatory effects were observed. The relative gene expression of IL-4 decreased by 55.1% for essential oil extracted from cypress wood, 69.6% for pine, 63.2% for pine nut, and 45.8% for Japanese larch compared with that in NC.
As shown in Fig. 2(b) wherein the relative gene expression of IL-13 as the factor controlling inflammatory reaction is depicted, the relative gene expression of IL-13 increased by 5.2 times compared with that in VE when LPS was used. In contrast, after LPS-induced RBL-2H3 mast cells were exposed to dexamethasone and the essential oils, the relative gene expression of IL-13 decreased substantially. When these cells were exposed to dexamethasone, the relative gene expression of IL-13 decreased by 79.8%. Compared with that in NC, the relative gene expression of IL-13 decreased by 51.1% for the essential oil extracted from cypress wood, 57.8% for pine, 57.1% for pine nut, and 34.5% for Japanese larch. Regarding all essential oils that inhibited the gene expressions of IL-4 and IL-13 in LPS-induced RBL-2H3 mast cells, allergic inflammation improved. All essential oils contain same substances including α-pinene, limonene, and 4-terpineol, which have anti-inflammatory effect (Rufino et al., 2015). Therefore, the observed anti- inflammatory effects may be thought to be caused by these substances.
Cytokines activate proteins and are secreted in cells in the presence of immune or inflammatory reactions, and they are involved in transmission of information across cells. When an allergic reaction occurs, various cells are activated that trigger an inflammatory reaction via the release and import of chemical media. At this point, many types of cytokines participate directly or indirectly (Kwon and Song, 2012.). IL-4 is a controller of IgE (a mediator of an allergic reaction), and mast cells mediate immunity. Further, an increase in IL-4 levels is crucial for an allergic reaction (Iikura et al., 2001), and IL-13 functions as an important mediator of IgE production and maintenance (Howard et al., 2001). Because the relative gene expressions of IL-4 and IL-13 decreased following exposure to the essential oils extracted from pine and pine nut wood compared with that to other essential oils, Th2 cell activity was possibly inhibited and immunity was effectively regulated leading to the inhibition of IgE production. Its effectiveness in inhibiting the release of inflammatory mediators indicates its effectiveness in inhibiting type I allergic reactions. Moreover, the excellent anti-inflammatory effect of essential oils extracted from pine and pine nut wood compared with that of other essential oils is considered to have been caused by the differences in the substances present in these essential oils. In particular, β-pinene and longifolene are present in pine and pine nut at a high level compared with those in cypress and Japanese larch. β-Pinene was the highest in pine (11.02%) followed by pine nut (10.79%), Japanese larch (2.96%), and cypress (0.24%). The differences in these major substances are assumed to have caused the differences in the effectiveness of different tree species.
The rate of β-hexosaminidase release, an index of exocytosis, was measured to assess the anti-inflammatory effects of the essential oils from the wood of the four coniferous tree species Fig. 3.
In VE, exocytosis was stimulated, leading to an increase in β-hexosaminidase release by 6.1 times compared with that in VE, and when dexamethasone (PC) was applied to LPS-induced mast cells, the release rate decreased by 77.9% compared with that in VE. Similar to that in PC, β-hexosaminidase release decreased in the group processed with the essential oils from the wood of the four coniferous tree species. When the essential oil extracted from cypress wood was used, the relative β-hexosaminidase release decreased by 38.1% compared with that in NC, by 33.0% when essential oil extracted from pine wood was used, by 27.4% when essential oil extracted from pine nut was used, and by 9.1% i essential oil extracted from Japanese larch was used. All essential oils inhibited β-hexosaminidase release in LPS-induced RBL-2H3 mast cells, suggesting that they have anti-inflammatory activity; this implies that the essential oils extracted from the wood of the four coniferous tree species inhibit exocytosis of RBL-2H3 mast cells caused by antigenic simulation, which differs according to the types of tree species.
β-Hexosaminidase is stored in secretory granules within mast cells. During immune activity, β-hexosaminidase is secreted with histamine and is used as the exocytosis marker for mast cells (Mastusa et al., 2002). Examination of the effect of the essential oils that affect β -hexosaminidase release, the essential oil extracted from cypress wood showed the highest inhibition rate, and the relatively high percentage of τ-muurolol and α-cadinol was remarkable. Given that RBL-2H3 mast cell exocytosis and the secretion of inflammatory mediators were effectively inhibited, τ-muurolol and α-cadinol are considered the mediators of type I allergic reactions. Moreover, IL-4 and IL-13 showed specific trends of gene expression, indicating that the essential oils extracted from the wood of pine and pine nut are effective in regulating inflammatory reaction by inhibiting Th2 cells. The essential oil extracted from cypress wood is the most effective in inhibiting inflammation-induced exocytosis. Such differences in the inhibitory effect according to the immunity pathway are considered because of the substances present in essential oils. Further studies are required to identify the bioactive substances responsible for anti-inflammatory effects.
4. CONCLUSION
In this study, bioactive substances and their effects on improving the anti-inflammatory effect of the essential oils extracted from the wood of cypress, pine, pine nut, and Japanese larch (the recommended tree species for timber designated by the Korea Forest Service) were studied.
The essential oils used in the experiments were extracted from grinded wood of the four coniferous tree species using hydrodistillation. Determination of their chemical composition using GC/MS revealed the prominent substances to be α-pinene, β-pinene, fenchol, and α-terpineol in all coniferous tree species, wherein each tree species showed different compositions of these major substances.
For the comparative analysis of the effects of bioactive substances on improving the anti-inflammatory effect of the essential oils extracted from the four coniferous tree species, inflammation was induced in RBL-2H3 mast cells by LPS and the essential oils were applied; then, inhibitory rates of exocytosis and β-hexosaminidase release were examined. Assessment of IL-4 and IL-13 gene expressions and β-hexosaminidase release rate in terms of inflammation, the relative IL-4 and IL-13 gene expressions stimulated by LPS decreased substantially following the application of essential oils extracted from the wood of pine and pine nut, whereas the highest inhibition of β-hexosaminidase release was observed for cypress. Compared with other essential oils, those extracted from the wood of pine and pine nut contained higher percentages of β-pinene and longifolene, whereas those extracted from the wood of cypress contained higher percentages of τ-muurolol and α-cadinol, which is thought to be the cause of different degree of effectiveness according to the immunity pathway. Thus, further research on the bioactive substances responsible for the anti-inflammatory effect is warranted. Through this study, the essential oils extracted from the wood of the four coniferous tree species were found to be effective in improving allergic inflammation. The bioactive substances in essential oils are diffused in air when cypress, pine, pine nut and Japanese larch trees are used as wood materials for interior construction. Therefore, these trees applied as materials in interior renovations, could contribute to effectively improve allergic inflammation.
