Original Article

Characterization of Low-Temperature Enzymatic Reactions through Heterologous Expression and Functional Analysis of Two Beta-Glucosidases from the Termite Symbiotic Bacterium Elizabethkingia miricola Strain BM10

Dongmin LEE1, Tae-Jong KIM1,https://orcid.org/0000-0002-7483-0432
Author Information & Copyright
1Department of Forest Products and Biotechnology, Kookmin University, Seoul 02707, Korea
Corresponding author: Tae-Jong KIM (e-mail: bigbell@kookmin.ac.kr)

Copyright 2023 The Korean Society of Wood Science & Technology. This is an Open-Access article distributed under the terms of the Creative Commons Attribution Non-Commercial License (http://creativecommons.org/licenses/by-nc/4.0/) which permits unrestricted non-commercial use, distribution, and reproduction in any medium, provided the original work is properly cited.

Received: May 02, 2023; Revised: Jun 04, 2023; Accepted: Jun 10, 2023

Published Online: Jul 25, 2023

ABSTRACT

Lower termites need symbiotic microbes for cellulose digestion. Elizabethkingia miricola strain BM10 has been proposed as a symbiotic microbe that assists in low-temperature digestion and metabolism of Reticulitermes speratus KMT1, a termite on Bukhan Mountain, Seoul, Korea. In E. miricola strain BM10, β-glucosidase genes expressed at 10°C were identified, and the psychrophilic enzymatic characteristic was confirmed by heterogeneously expressed proteins. Crude β-glucosidase in the culture broth of E. miricola strain BM10 showed specific enzymatic properties, and its substrate affinity was 4.69 times higher than that of Cellic CTec2. Among the genes proposed as β-glucosidase, two genes, bglB_1 and bglA_2, whose gene expression was more than doubled at 10°C than at 30°C, were identified. They were heterogeneously expressed in Escherichia coli and identified as psychrophilic enzymes with an optimal reaction temperature of about 20°C–25°C. In this study, E. miricola strain BM10, a symbiotic bacterium of lower termites, produced psychrophilic β-glucosidases that contribute to the spread of the low-temperature habitat of a lower termite, R. speratus KMT1.

Keywords: heterogeneous gene expression; high substrate affinity; psychrophilic β-glucosidase; symbiotic bacterium; termite

1. INTRODUCTION

Termites are wood-eating pests (Arinana et al., 2022; Su and Scheffrahn, 2000). Since termites damage wooden buildings, many studies have been conducted to control them in various ways (Adfa et al., 2020, 2023; Arsyad et al., 2020; Cahyono et al., 2020; Ella Nkogo et al., 2022; Im and Han, 2020; Lee et al., 2020; Oramahi et al., 2022; Priadi et al., 2023). However, they also serve as ecological suppliers providing various nutrients, including nitrogen compounds (Govorushko, 2019; Lobry de Bruyn and Conacher, 1990). They are widely distributed worldwide (Bourguignon et al., 2016), including Korea with freezing temperatures in winter (Cho et al., 2010b; Kim et al., 2012). In Korea, a representative lower termite species is Reticulitermes speratus (Cho et al., 2010b; Kim et al., 2012). It requires symbiotic microbes for the digestion of woody cellulose (Peterson and Scharf, 2016). Therefore, in the digestive tract of R. speratus, symbiotic microbes that aid in digestion must exist at low temperatures. In a previous study, a microorganism that produces β-glucosidase at 10°C was proposed among the symbiotic microorganisms in the gut of termites (Lee et al., 2018). In this study, we aim to show that the proposed low-temperature-produced β-glucosidases are not simply enzymes produced at low temperature, but that their enzymatic properties also have low-temperature enzymatic reaction characteristics.

Reticulitermes flavipes has been reported to survive at low temperatures. In the range of 8.1°C to 5.7°C, it enters a cold coma, and half of individuals have been reported to die (LT50) after 1 hour at –5.1°C (Clarke et al., 2013). Porotermes adamsoni and Stolotermesvictoriensis were active near 0°C, and half of individuals dying at –5.66°C and –7.32°C, respectively (Lacey et al., 2010). For R. speratus, half of the individuals died at –8.0°C, –8.0°C, –6.6°C, and –6.4°C after a 2-hour incubation of kings, queens, workers, and soldiers, respectively (Takata et al., 2023).

Cellulose, the main nutritional source found in wood, is efficiently broken down by three types of enzymes known as cellulases: endo-β-1,4-glucanase (EG), cellobiohydrolase (CBH), and β-glucosidase (Kumar et al., 2008). When termites crush cellulose, it undergoes degradation into smaller molecules through the action of EG, which is secreted by their salivary glands. In the case of the lower termite such as R. speratus, the cellulose is further converted into glucose with the additional CBH and β-glucosidase enzymes produced by symbiotic microorganisms in the termite’s gut. It has been suggested that R. speratus possesses three EG enzymes (Ahn and Kim, 2021), and certain symbiotic microorganisms also possess an EG enzyme (Otagiri et al., 2013). Significant reduction in cellulase activity within the hindgut was observed when bacteria were eliminated by ampicillin in Nasutitermes takasagoensi, indicating the involvement of symbiotic microorganisms in cellulose digestion (Tokuda and Watanabe, 2007). Symbiotic microbes found in termites produce CBH and β-glucosidase, but not EG, which are responsible for the initial breakdown of cellulose into smaller molecular weights (Cho et al., 2010a). This observation may be attributed to symbiotic adaptation, considering that the initial reduction in cellulose molecular weight occurs by EG produced in the termite’s mouth, and EG is not required for the subsequent stages of digestion. The population of the symbiotic bacterial community is conserved across different termites due to adaptations resulting from common dietary habits (Arora et al., 2022; Waidele et al., 2019).

The β-glucosidase production of bacteria isolated from the gut of R. speratus KMT1 shows various temperature specificities (Lee et al., 2018). In particular, Elizabethkingia miricola strain BM10 produces the maximum β-glucosidase activity at 10°C and exhibits a sharp decrease in β-glucosidase activity when the growth temperature is increased to 20°C. Therefore, E. miricola strain BM10 likely provides a decomposition mechanism of symbiotic microbes necessary for cellulose catabolism under low-temperature growth conditions of R. speratus KMT1.

In this study, the enzymatic characteristics of β-glucosidase produced by E. miricola strain BM10 at low temperature were analyzed. The psychrophilic β-glucosidase genes were identified by increased gene expression level by shifting the cell culture temperature from 30°C to 10°C. Two selected β-glucosidase genes were produced by heterologous expression in Escherichia coli and shown to be psychrophilic enzymes by characterizing the optimal reaction temperature.

2. MATERIALS and METHODS

2.1. Strain and chemicals

E. miricola strain BM10 was isolated from the digestive tracts of R. speratus KMT1 (Lee et al., 2015).

The following media were prepared using the given components: tryptone yeast extract (TYE) medium with 1% tryptone (REF: 211705, Becton Dickinson, Seoul, Korea) and 0.5% yeast extract (REF: 212750, Becton Dickinson); yeast extract peptone (YEP) medium with 0.2% yeast extract and 0.8% peptone (REF: 211677, Becton Dickinson) in 0.1 M phosphate buffer (pH 7.0) made with sodium phosphate monobasic dihydrate (Product#: 1429, Duksan, Ansan, Korea) and sodium phosphate dibasic anhydrous (Product#: 1490, Duksan); Luria–Bertani medium with 1% LB broth (REF: 244620, Becton Dickinson); and lysis buffer with 50 mM NaH2PO4, 300 mM NaCl, and 10 mM imidazole. Agar plates were made with the corresponding medium and 1.5% Bacto agar (REF: 214010, Becton Dickinson). Carboxymethyl cellulose (CMC, Catalog number: R7257) was purchased from Sigma-Aldrich (Seoul, Korea).

2.2. β-glucosidase activity of cell free culture broth

E. miricola strain BM10 stored at –80°C was streaked on agar plates with the TYE medium, 1% CMC, and 1.5% Bacto agar. Cells were incubated at 26°C for 2 days. A single colony was inoculated in 5 mL of TYE medium with 1% CMC and incubated at 26°C for 2 days while shaking at 250 rpm. The precultured cells were inoculated into 100 mL of YEP medium with 2% CMC and cultured at 10°C for 3 days while shaking at 250 rpm. After 3 days in the main culture, 0.002% sodium azide was added, and the cells were removed by centrifugation with 12,000×g at 4°C for 10 min. The cell free supernatant of the main culture was used to measure the β-glucosidase activity at 30°C and pH 7 (Lee et al., 2018). The 20 μL of enzyme was mixed with 160 μL of 0.1 M potassium phosphate buffer (pH 7.0) and 20 μL of 10 mM ρ-nitrophenyl-β-D-glucopyranoside, incubated at 30°C for 30 min, and the reaction was stopped by mixing 20 μL of 2 M calcium carbonate. Absorbance was measured at a wavelength of 405 nm and the amount of ρ-nitrophenol produced was calculated using a ρ-nitrophenol standard curve. One unit of activity was defined as the amount of β-glucosidase activity that generated 1 μmol ρ-nitrophenol/min. The Cellic CTec2 (Novozymes A/S, Bagsværd, Denmark) was used as a positive control after 1/40,000 dilution. The Lineweaver–Burk equation was obtained using 1/[S] (1/mM) for χ value and 1/V (mL·min/μmol-ρ-nitrophenol) for y values.

2.3. β-glucosidase genes in Elizabethkingia miricola strain BM10 and measurement of gene expression levels via real-time polymerase chain reaction (RT-PCR)

The complete chromosomal DNA sequence of E. miricola strain BM10 is available at the National Center for Biotechnology Information (https://ncbi.nlm.nih.gov/; GenBank number: CP011059). The six proteins with β-glucosidase in the description were selected, and their closest proteins in the protein database were identified using protein BLAST.

E. miricola strain BM10 was cultured in accordance with the procedures described in the section “β-glucosidase activity of cell free culture broth”. Cells were harvested by centrifugation with 12,000×g at 4°C for 10 min. TRIzol® (1 mL; Catalog number: 15596026, Thermo Fisher Scientific, Seoul, Korea) was added and incubated at 4°C for 5 min. The cells were rapidly frozen and disrupted using TissueLyser LT (Qiagen, Seoul, Korea). After centrifugation at 12,000×g for 10 min, the supernatant was separated and mixed well with 200 μL of chloroform. The mixture was incubated at 23°C for 3 min. After another centrifugation at 12,000×g for 15 min, the supernatant was separated and mixed with 500 μL of isopropanol. The mixture was incubated at 23°C for 10 min, and the precipitated pellet was harvested by centrifugation at 12,000×g for 15 min. The pellet was rinsed with 1 mL of 75% cold ethanol. The extracted RNA was dried and dissolved in pure water treated with 0.1% (v/v) of diethyl pyrocarbonate. For cDNA synthesis, a mixture was made using M-MLV Reverse Transcriptase (Catalog number: M2410, GenDEPOT, Dawinbio, Hanam, Korea) in accordance with the manufacturer’s protocol. cDNA was synthesized at 42°C for 60 min, and the enzyme was inactivated by boiling for 10 min.

For RT-PCR, seven primer pairs of 6 β-glucosidase candidate genes and glyceraldehyde 3-phosphate dehydrogenase A gene as a reference gene of E. miricola strain BM10 were designed: 0821F (5’-GAAGGATTGG GACTGGGAAT-3’) and 0821R (CAAATTTCTGCACC AGCTCA) for bglX_1; 1398F (CTGGTTTCCGGTAAT GCTGT) and 1398R (CCATCTGATGAGCTGCGTTA) for bglB_1; 3284F (AGCCAAGATGGGGAAGAGTT) and 3284R (CTTCCGGTGCTCCATACAGT) for bglX_2; 3419F (ACCATCCAATAATCCGGTGA) and 3419R (TTTTCTGAGGGTTCCACAGG) for bglX_3; 3735F (GCCACTGCTTTTCCTGTAGC) and 3735R (CATTTT CCTGAACGCCATTT) for bglB_2; 3904F (CCCGGCA GAAAAAGTATTGA) and 3904R (CGGTTAAGCAAA AGGTCTGC) for bglA_2; and G3PDHF (CACGGGC AATTTAAAGGAGA) and G3PDHR (GCGTTAATGT GAGCTTGTGC) for gapA.

RT-PCR was performed with 10 μL of iQTM SYBR®Green Supermix (Catalog number: 1708880, Bio-Rad Laboratories, Hercules, CA, USA), 1 μL of forward primer, 1 μL of reverse primer, 1 μL of cDNA, and 7 μL of deionized water under the following reaction conditions: 1 cycle at 95°C for 5 min; 40 cycles at 95°C for 45 s, 55°C for 30 s, and 72°C for 30 s; and 1 cycle at 72°C for 10 min. The specificity of the RT-PCR products was confirmed through melting curve analysis between 60°C and 95°C. RT-PCR was performed thrice.

2.4. Heterogeneous expression of bglB_1 and bglA_2 in Escherichia coli TOP10

The expression plasmid was constructed and transformed into E. coli TOP 10 by Cosmogentech (Seoul, Korea). bglB_1 and bglA_2 were amplified through PCR. Since bglB_1 was difficult to amplify by a single PCR experiment, internal primers were used to amplify bglB_1 in two segments. Subsequently, the resulting PCR products were combined and used as the template for a subsequent PCR reaction to amplify the complete bglB_1 gene. The primers for bglB_1 were BGLB1-NdeIF (CGCGCGGCAGCCATATGCTGAAGAGAATT ATCTTAGCC), BGLB1-XhoIR (GGTGGTGGTGCTCGAGTTACTGAAGTGTAAACTTCAC), BGLB1-intP1 (GAATTCCGCCATACTAGC), and BGLB1-intP2 (TAAGATGATGACTGTTGG). The primers for bglA_2 were BGLA2-NdeIF (CGCGCGGCAGCCATATGTTA TTGACAAAGGAAGCC) and BGLA2-XhoIR (GGTGG TGGTGCTCGAGTTATTTAATAAAATCGGCATACC). The restriction enzyme sites of NdeI in BGLB1-NdeIF and BGLA2-NdeIF and XhoI in BGLB1-XhoIR and BGLA2-XhoIR were underlined. PCR was performed with 1 μL of cDNA template, 5 μL of the forward primer, 5 μL of the reverse primer, 1 μL of Pfu DNA polymerase, 4 μL of dNTP mixture, 10 μL of 5× reaction buffer, and 24 μL of distilled water under the following reaction conditions: 1 cycle at 95°C for 5 min; 35 cycles at 95°C for 60 s, 55°C for 60 s, and 72°C for 60 s per kilobase; and 1 cycle at 72°C for 7 min.

The vector, pET28a, and the PCR products were cut by NdeI and XhoI. The cut pET28a with 4 μL was mixed with 1 μL of the PCR-amplified gene, 1 μL of ligase, 1 μL of 10× reaction buffer, and 3 μL of distilled water. After incubation at 23°C for 150 s, the mixture was cooled down at 4°C for 10 min. The ligated recombinant pET28a was transformed into E. coli Top10 via the heat shock method at 42°C for 90 s. The successful transformant produced colonies on LB agar plates with 50 μg/mL kanamycin. The recombinant plasmid was confirmed through colony PCR.

pET28a with the inserted gene was transformed into E. coli BL21 strain via the heat shock method, and the transformed cells were spread on LB agar plates with 50 μg/mL kanamycin. After colony selection, single colonies were obtained by streaking on LB agar plates with 50 μg/mL kanamycin again. The cells were cultured in LB broth at 37°C overnight and stored with 25% glycerin at –80°C.

For protein production, the cells were streaked and grown on LB agar plates with 50 μg/mL kanamycin. A single colony was inoculated in 5 mL of LB medium test tubes and inoculated at 37°C overnight. The precultured cells was inoculated into 100 mL of LB broth and cultured at 17°C for 18 h. Protein expression was induced by 0.01 mM isopropyl β-D-1-thiogalactopyranoside (IPTG; Catalog number: I0355, GenDEPOT).

Cells were harvested by centrifugation at 4,000×g for 20 min. The cell pellet was resuspended in 5 mL of lysis buffer and mixed with 25 μg/mL lysozyme. After incubation for 30 min, the cells were disrupted through sonication. Cellular extracts were centrifuged at 10,000×g for 20 min to separate the supernatant (soluble protein) from the pellet (insoluble protein). For protein analysis, proteins were denatured at 95°C for 5 min and separated via sodium dodecyl sulfate-polyacrylamide gel electrophoresis with 10% polyacrylamide. Proteins were stained with Coomassie brilliant blue R (Sigma-Aldrich).

2.5. Determination of the optimal reaction conditions of heterologous expressed β-glucosidases

The β-glucosidase activity of heterologous expressed β-glucosidases was measured using the supernatant of cell-free extracts in accordance with previously described methods (Lee et al., 2018) with some modifications. For enzyme activity measurement, the conditions used other than the conditions to be determined in each experiment were 20°C and pH 7.

Temperature-related changes in β-glucosidase activity were measured in the range of 5°C to 45°C at 5°C intervals to evaluate the psychrophilic enzymatic characteristics. The effect of pH on the β-glucosidase activity was determined with 100 mM sodium citrate buffer (pH 3-6), 100 mM sodium phosphate buffer (pH 6-8), and 100 mM Tris-HCl buffer (pH 8-9). For the thermostability test, enzyme activities were examined at the indicated temperature after incubation for the indicated time in each experiment. Ion-induced changes in β-glucosidase activity were examined with 1 mM of CuSO4, MnCl2, CoCl2, MgCl2, BaCl2, KCl, FeSO4, ZnSO4, FeCl3, CaCl2, and NaCl in order to evaluate the inhibitory effect of ions (Singh et al., 2023; Yan and Lin, 1997).

3. RESULTS and DISCUSSION

3.1. Enzymatic kinetic analysis of β-glucosidase activity in the cell-free culture broth

In a previous study, the maximum activity of β-glucosidase from E. miricola strain BM10 was detected at 10°C, and less than 20% of β-glucosidase activity was observed at above 20°C compared with that at 10°C (Lee et al., 2018). Enzyme kinetic analysis was performed to reveal the enzymatic characteristics of β-glucosidase expressed at a low temperature (Fig. 1). Since the β-glucosidase activity of Cellic CTec2, a positive control, was too high, it was diluted 40,000 times to resemble the β-glucosidase activity of E. miricola strain BM10. Enzyme activity affects Vmax (the maximal reaction velocity when the enzyme is saturated with its substrate) but not Km (the substrate concentration at which half of the maximum reaction velocity is reached) because of the unique nature of the enzyme. Km is an index indicating the affinity of an enzyme to its substrate; the lower the Km, the higher the substrate affinity. E. miricola strain BM10 and diluted Cellic CTec2 had Km of 1.01 and 4.74 mM, respectively. The Km of β-glucosidase from Cellic CTec2 was 4.69 times higher than that of β-glucosidase from E. miricola strain BM10. This relatively low Km indicated that the β-glucosidase from E. miricola strain BM10 had a 4.69-fold higher substrate affinity than Cellic CTec2. Enzymes generally react more rapidly with increasing temperature until they are inactivated through denaturation. High substrate affinity is a way to increase the reaction rate of enzymes, allowing them to maintain their activity even at low temperatures. Fig. 1 suggested that the reaction rate of β-glucosidase from E. miricola strain BM10 could be maintained at low temperatures by increasing substrate affinity. Many β-glucosidases have been reported to have low Km (Bockwoldt and Ehrmann, 2022; DelPozo et al., 2012; Pyeon et al., 2019; Zhou et al., 2011), and their optimum reaction temperature is 35°C–55°C. Crude enzymes do not accurately represent the properties of specific enzymes. However, the high substrate affinity of the crude enzyme confirmed the existence of psychrophilic β-glucosidases, and it was necessary to identify psychrophilic β-glucosidases to support the low-temperature habitat of R. speratus KMT1.

wood-51-4-270-g1
Fig. 1. Lineweaver–Burk plot showing the results of the enzymatic kinetic analysis of the β-glucosidase activity of the cell culture broth of Elizabethkingia miricola strain BM10 (■) and Cellic CTec2 (□). The substrate was ρ-nitrophenyl-β-D-glucopyranoside.
Download Original Figure
3.2. β-glucosidase genes in Elizabethkingia miricola strain BM10

The complete chromosomal sequence of E. miricola strain BM10 was registered with accession number CP011059 at the National Center for Biotechnology Information (Lee et al., 2015). Six β-glucosidase genes were found in the entire chromosome of E. miricola strain BM10 (Table 1). The most homologous non-Elizabethkingia proteins, along with the names and amino acid numbers of the six genes, were displayed in the protein database. The percent identity of the six genes with the most homologous protein ranged from 67% to 85%. This low percent identity range with the closest proteins suggested that the β-glucosidases from E. miricola strain BM10 may have unique enzymatic characteristics that differ from those of other currently reported species.

Table 1. Relative β-glucosidase (EC 3.2.1.21) genes of Elizabethkingia miricola strain BM10 (GenBank: CP011059) and their highest “percent identity” protein outside of Elizabethkingia in the protein database of the National Center for Biotechnology Information
Protein ID Description Gene name Amino acid number The protein with the highest percent identity in the protein database
Accession number Scientific name of strain having protein Query coverage (%) Percent identity (%)
AJW62307 Periplasmic β-glucosidase precursor bnglX_1 766 WP_073290053 Chryseobacterium polytrichastri 100 82.51
AJW62880 Thermostable β-glucosidase B bglB_1 753 WP_103290166 Chryseobacterium lactis 100 85.13
AJW64715 Periplasmic β-glucosidase precursor bglX_2 773 OJX30905 Chryseobacterium sp. 36-9 100 78.71
AJW64849 Periplasmic β-glucosidase precursor bglX_3 827 WP_223581078 Sphingobacterium sp. GVS05A 95 67.64
AJW65161 Thermostable β-glucosidase B bglB_2 216 MCG2793578 Weeksellaceae bacterium 98 82.63
AJW65329 β-glucosidase A bglA_2 444 WP_115171992 Sphingobacterium spiritivorum 100 84.23
Download Excel Table
3.3. Expression level of β-glucosidase genes from Elizabethkingia miricola strain BM10 at 10°C

Since E. miricola strain BM10 showed a maximum β-glucosidase activity when grown at 10°C (Lee et al., 2018), β-glucosidase would be expressed at 10°C. The expression levels of the genes proposed as β-glucosidase at 10°C and 30°C were compared through RT-PCR (Fig. 2). The genes whose expression levels were more than doubled at 10°C than at 30°C were bglB_1 (6.98-fold) and bglA_2 (2.28-fold). These results suggested that bglB_1 and bglA_2 were responsible for the high β-glucosidase activity at 10°C in E. miricola strain BM10.

wood-51-4-270-g2
Fig. 2. Comparison of gene expression levels at 10°C and 30°C through RT-PCR. Six putative β-glucosidase genes from Table 1 were tested. The experiment was repeated thrice and the average and SD are shown. RT-PCR: real-time polymerase chain reaction.
Download Original Figure
3.4. Heterologous expression of bglB_1 and bglA_2 in Escherichia coli

bglB_1 and bglA_2 were independently inserted into the pET28a vector, and the recombinant plasmids were obtained from E. coli TOP10. The inserted gene in the recombinant plasmids was confirmed through sequencing analysis (data not shown). The confirmed recombinant plasmids were introduced in the expression strain E. coli BL21. The expression of both genes was induced with 0.01 mM IPTG at 17°C for 18 h. Large amounts of proteins with the desired size were produced in the cells by IPTG for each protein compared with those in the cells without the expressed genes (Fig. 3). Most of the produced proteins were observed in the inclusion bodies, and only a small amount of the protein was produced in a soluble state.

wood-51-4-270-g3
Fig. 3. Heterologous expression of bglB_1 (A) and bglA_2 (B) in Escherichia coli. Proteins were analyzed via sodium dodecyl sulfate-polyacrylamide gel electrophoresis. The proteins in the cells without induction (BI) and with induction (AI) were analyzed to verify the protein expression. After cell extract separation, soluble proteins (SP) in the cell-free supernatant and insoluble proteins (IP) in the pellet were examined to measure protein partition. The arrows on the right side of the picture indicated the expected position of the expressed proteins. The protein size marker (M) showed the expected protein size.
Download Original Figure

After the proteins were produced, their β-glucosidase activities were measured using the soluble fraction. The β-glucosidase activities of AJW62880 (the protein of bglB_1) and AJW65329 (the protein of bglA_2) at 17°C were 1.582 ± 0.013 and 0.350 ± 0.011 U/mL, respectively. The β-glucosidase activities were 7.5-fold higher for bglB_1-expressing cells and 1.6-fold higher for bglA_2-expressing cells than those of 0.210 U/mL in the cell-free culture medium of E. miricola strain BM10. Although many expressed proteins were insoluble, a sufficient enzyme activity was observed in soluble proteins to characterize the enzymes.

3.5. Enzymatic characteristics of heterologous expressed β-glucosidases

The enzymatic characteristics of β-glucosidase were evaluated with the heterologous expressed soluble enzyme. In the case of AJW62880, the optimum reaction temperature and pH were 20°C (Fig. 4A) and 6.5 (Fig. 4B), respectively. In the thermostability test (Fig. 4C), most of the β-glucosidase activity remained at 30°C for 2 h, but the enzyme activity rapidly disappeared within 15 min at 40°C. No significant ion-induced changes in enzyme activity were observed (Fig. 4D). Even when the enzyme activity was slightly reduced by some ions, the enzyme activity was not significantly changed, considering that the enzyme activity was not changed by the same ion provided as a different type of salt.

wood-51-4-270-g4
Fig. 4. Effect of reaction conditions on β-glucosidase activity of AJW62880. The effect of reaction temperature (A) and pH (B), thermostabilities (C), and the inhibitory activity of ions (D) on the β-glucosidase activity were evaluated. In the panel B, citrate buffer (▲) for pH 3–6, phosphate buffer (●) for pH 6–8, and tris buffer (■) for pH 8–9 were used. In the panel C, temperatures at 10°C (■), 20°C (♦), 30°C (▲), 40°C (●), and 50°C(□) were tested. In the panel D, salt concentration was 1 mM. The experiment was repeated thrice and the average and SD are shown.
Download Original Figure

In the case of AJW65329, the optimum reaction temperature and pH were 25°C (Fig. 5A) and 7.0 (Fig. 5B), respectively. In the thermostability test (Fig. 5C), similar to that observed in AJW62880, β-glucosidase activity was mostly maintained at 30°C for 2 h. However, at 40°C, the enzyme activity of AJW65329 disappeared more slowly than that of AJW62880. The β-glucosidase activity of AJW65329 was severely affected by ions (Fig. 5D). Particularly, CuSO4, FeSO4, and ZnSO4 strongly inhibited the enzyme activity by more than 60%.

wood-51-4-270-g5
Fig. 5. Effect of reaction conditions on β-glucosidase activity of AJW65329. The effect of reaction temperature (A) and pH (B), thermostabilities (C), and the inhibitory activity of ions (D) on the β-glucosidase activity were evaluated. In the panel B, citrate buffer (▲) for pH 3–6, phosphate buffer (●) for pH 6–8, and tris buffer (■) for pH 8–9 were used. In the panel C, temperatures at 10°C (■), 20°C (♦), 30°C (▲), 40°C (●), and 50°C (□) were tested. In the panel D, salt concentration was 1 mM. The experiment was repeated thrice and the average and SD are shown.
Download Original Figure

The enzymatic kinetics of two heterologous expressed β-glucosidases were analyzed (Fig. 6). AJW62880 and AJW65329 had Km of 48.53 and 17.92 mM, respectively. The substrate affinities of these two β-glucosidases were approximately 10 and 4 times lower than that of Cellic CTec2, which had Km of 4.74. This result is contrary to the high substrate affinity of β-glucosidase in the cell culture broth. This contrary Km value suggested that the enzyme structure was partially modified according to heterologous expression; thus, enzymatic characteristics changed, or a specific substance present in the cell culture broth increased the substrate affinity of β-glucosidase.

wood-51-4-270-g6
Fig. 6. Lineweaver–Burk plot of the results of the enzymatic kinetic analysis of the β-glucosidase activities of heterologously expressed AJW62880 (▲), heterologously expressed AJW65329 (■), and CellicCTec2 (♦).
Download Original Figure

In a previous study, a low-temperature-active β-glucosidase was obtained from symbiotic Serratia sp. TN49 isolated from the gut of longhorned beetle (Batocera horsfieldi) larvae (Zhou et al., 2011), and its optimum reaction temperature is 35°C. In the present study, the optimal reaction temperature of two heterologous expressed β-glucosidases was 20°C–25°C, and the expression of E. miricola strain BM10 psychrophilic β-glucosidases at 10°C (Lee et al., 2018) suggested that AJW62880 and AJW65329 were β-glucosidases more optimized for low temperatures. R. speratus KMT1 feeds on wood and requires the help of commensal microorganisms in the gut to digest wood. To survive in regions with sub-zero temperatures in winter, R. speratus KMT1 needs symbiotic microorganisms that help in digestion in the intestines. Therefore, the results of this study provided an ecological basis for the spread of termite habitats in low-temperature regions.

Further studies may reveal the structural features of psychrophilic β-glucosidases with a high substrate affinity and identify the regulatory mechanism of cold gene expression specifically at 10°C.

4. CONCLUSIONS

E. miricola strain BM10, a termite-symbiotic bacterium, produced β-glucosidase with high substrate affinity at 10°C to have an efficient enzymatic reaction even at low temperatures. Two β-glucosidase genes, bglB_1 and bglA_2, expressed by E. miricola strain BM10 at low temperatures were identified. The heterologous expression of the identified genes in Escherichia coli confirmed that they were psychrophilic β-glucosidases with an optimal reaction temperature of 20°C–25°C. These results demonstrated that symbiotic microbes provided low-temperature-specific enzymes necessary for the survival of termites at low temperatures. Such symbiotic microbes allow termites to expand their habitats to low-temperature regions.

CONFLICT of INTEREST

No potential conflict of interest relevant to this article was reported.

ACKNOWLEDGMENT

This study was carried out with the support of ‘R&D Program for Forest Science Technology (Project No. 2023473B10-2325-EE02)’ provided by Korea Forest Service (Korea Forestry Promotion Institute).

REFERENCES

1.

Adfa, M., Romayasa, A., Kusnanda, A.J., Avidlyandi, A., Yudha, S.S., Banon, C., Gustian, I. 2020. Chemical components, antitermite and antifungal activities of Cinnamomum parthenoxylonwood vinegar. Journal of the Korean Wood Science and Technology 48(1): 107-116.

2.

Adfa, M., Wiradimafan, K., Pratama, R.F., Sanjaya, A., Triawan, D.A., Yudha, S.S., Ninomiya, M., Rafi, M., Koketsu, M. 2023. Anti-termite activity of Azadirachta excelsa seed kernel and its isolated compound against Coptotermes curvignathus. Journal of the Korean Wood Science and Technology 51(3): 157-172.

3.

Ahn, H.H., Kim, T.J. 2021. Three endogenous cellulases from termite, Reticulitermes speratus KMT001. Archives of Insect Biochemistry and Physiology 106(3): e21766.

4.

Arinana, A., Rahman, M.M., Silaban, R.E.G., Himmi, S.K., Nandika, D. 2022. Preference of subterranean termites among community timber species in Bogor, Indonesia. Journal of the Korean Wood Science and Technology 50(6): 458-474.

5.

Arora, J., Kinjo, Y., Šobotník, J., Buček, A., Clitheroe, C., Stiblik, P., Roisin, Y., Žifčáková, L., Park, Y.C., Kim, K.Y., Sillam-Dussès, D., Hervé, V., Lo, N., Tokuda, G., Brune, A., Bourguignon, T. 2022. The functional evolution of termite gut microbiota. Microbiome 10(1): 78.

6.

Arsyad, W.O.M., Efiyanti, L., Trisatya, D.R. 2020. Termiticidal activity and chemical components of bamboo vinegar against subterranean termites under different pyrolysis temperatures. Journal of the Korean Wood Science and Technology 48(5): 641-650.

7.

Bockwoldt, J.A., Ehrmann, M.A. 2022. Characterisation of recombinant GH 3 β-glucosidase from β-glucan producing Levilactobacillus brevis TMW 1.2112. Antonie van Leeuwenhoek 115(8): 955-968.

8.

Bourguignon, T., Lo, N., Šobotník, J., Sillam-Dussès, D., Roisin, Y., Evans, T.A. 2016. Oceanic dispersal, vicariance and human introduction shaped the modern distribution of the termites Reticulitermes, Heterotermes and Coptotermes. Proceedings of the Royal Society B: Biological Sciences 283(1827): 20160179.

9.

Cahyono, T.D., Yanti, H., Anisah, L.N., Massijaya, M.Y., Iswanto, A.H. 2020. Linear expansion and durability of a composite boards (MDF laminated using three selected wood veneers) against drywood termites. Journal of the Korean Wood Science and Technology 48(6): 907-916.

10.

Cho, M.J., Kim, Y.H., Shin, K., Kim, Y.K., Kim, Y.S., Kim, T.J. 2010a. Symbiotic adaptation of bacteria in the gut of Reticulitermes speratus: Low endo-β-1,4-glucanase activity. Biochemical and Biophysical Research Communications 395(3): 432-435.

11.

Cho, M.J., Shin, K., Kim, Y.K., Kim, Y.S., Kim, T.J. 2010b. Phylogenetic analysis of Reticulitermes speratus using the mitochondrial cytochrome C oxidase subunit I gene. Journal of the Korean Wood Science and Technology 38(2): 135-139.

12.

Clarke, M.W., Thompson, G.J., Sinclair, B.J. 2013. Cold tolerance of the eastern subterranean termite, Reticulitermes flavipes (Isoptera: Rhinotermitidae), in Ontario. Environmental Entomology 42(4): 805-810.

13.

DelPozo, M.V., Fernández-Arrojo, L., Gil-Martínez, J., Montesinos, A., Chernikova, T.N., Nechitaylo, T.Y., Waliszek, A., Tortajada, M., Rojas, A., Huws, S.A., Golyshina, O.V., Newbold, C.J., Polaina, J., Ferrer, M., Golyshin, P.N. 2012. Microbial β-glucosidases from cow rumen metagenome enhance the saccharification of lignocellulose in combination with commercial cellulase cocktail. Biotechnology for Biofuels 5: 73.

14.

EllaNkogo, L.F., Bopenga Bopenga, C.S.A., Ngohang, F.E., Mengome, L.E., Aboughe Angone, S., Edou Engonga, P. 2022. Phytochemical and anti-termite efficiency study of Guibourtia tessmanii (harms) J. Léonard (Kévazingo) bark extracts from Gabon. Journal of the Korean Wood Science and Technology 50(2): 113-125.

15.

Govorushko, S. 2019. Economic and ecological importance of termites: A global review. Entomological Science 22(1): 21-35.

16.

Im, I.G., Han, G.S. 2020. Laboratory evaluation of the marking effect of Sudan Red 7B on subterranean termites (Reticulitermes speratus) in Republic of Korea. Journal of the Korean Wood Science and Technology 48(5): 745-754.

17.

Kim, M.J., Choi, Y.S., Lee, J., Kim, J.J., Kim, G.H. 2012. Molecular characteristics of subterranean termites of the genus Reticulitermes (Isoptera: Rhinotermitidae) from Korea. Annals of the Entomological Society of America 105(1): 97-102.

18.

Kumar, R., Singh, S., Singh, O.V. 2008. Bioconversion of lignocellulosic biomass: Biochemical and molecular perspectives. Journal of Industrial Microbiology and Biotechnology 35(5): 377-391.

19.

Lacey, M.J., Lenz, M., Evans, T.A. 2010. Cryoprotection in dampwood termites (Termopsidae, Isoptera). Journal of Insect Physiology 56(1): 1-7.

20.

Lee, D., Kim, Y.K., Kim, Y.S., Kim, T.J. 2015. Complete genome sequence of Elizabethkingia sp. BM10, a symbiotic bacterium of the wood-feeding termite Reticulitermes speratus KMT1. Genome Announcements 3(5): e01181-15.

21.

Lee, D., Kim, Y.S., Kim, Y.K., Kim, T.J. 2018. Symbiotic bacterial flora changes in response to low temperature in Reticulitermes speratus KMT001. Journal of the Korean Wood Science and Technology 46(6): 713-725.

22.

Lee, J.M., Kim, Y.H., Hong, J.Y., Lim, B., Park, J.H. 2020. Exploration of preservatives that inhibit wood feeding by inhibiting termite intestinal enzyme activity. Journal of the Korean Wood Science and Technology 48(3): 376-392.

23.

Lobryde Bruyn, L., Conacher, A.J. 1990. The role of termites and ants in soil modification: A review. Australian Journal of Soil Research 28(1): 55-93.

24.

Oramahi, H.A., Tindaon, M.J., Nurhaida, N., Diba, F., Yanti, H. 2022. Termicidal activity and chemical components of wood vinegar from nipah fruit against Coptotermes curvignathus. Journal of the Korean Wood Science and Technology 50(5): 315-324.

25.

Otagiri, M., Lopez, C.M., Kitamoto, K., Arioka, M., Kudo, T., Moriya, S. 2013. Heterologous expression and characterization of a glycoside hydrolase family 45 endo-β-1,4-glucanase from a symbiotic protist of the lower termite, Reticulitermes speratus. Applied Biochemistry and Biotechnology 169(6): 1910-1918.

26.

Peterson, B.F., Scharf, M.E. 2016. Lower termite associations with microbes: Synergy, protection, and interplay. Frontiers in Microbiology 7: 422.

27.

Priadi, T., Putra, G.S., Cahyono, T.D. 2023. Reliability of the impregnated boron compounds, citric acid- and heat-treated samama (Anthocephalus macrophyllus) wood against the fungal and termite attacks. Journal of the Korean Wood Science and Technology 51(1): 49-57.

28.

Pyeon, H.M., Lee, Y.S., Choi, Y.L. 2019. Cloning, purification, and characterization of GH3 β-glucosidase, MtBgl85, from Microbulbifer thermotolerans DAU221. PeerJ 7: e7106.

29.

Singh, N., Sithole, B., Kumar, A., Govinden, R. 2023. A glucose tolerant β-glucosidase from a newly isolated Neofusicoccum parvums train F7: Production, purification, and characterization. Scientific Reports 13(1): 5134.

30.

Su, N.Y., Scheffrahn, R.H. 2000. Termites as Pests of Buildings. In: Termites: Evolution, Sociality, Symbioses, Ecology, Ed. by Abe, T., Bignell, D.E., and Higashi, M. Springer, Dordrecht, Netherlands. pp. 437-453.

31.

Takata, M., Konishi, T., Nagai, S., Wu, Y., Nozaki, T., Tasaki, E., Matsuura, K. 2023. Discovery of an underground chamber to protect kings and queens during winter in temperate termites. Scientific Reports 13(1): 8809.

32.

Tokuda, G., Watanabe, H. 2007. Hidden cellulases in termites: Revision of an old hypothesis. Biology Letters 3(3): 336-339.

33.

Waidele, L., Korb, J., Voolstra, C.R., Dedeine, F., Staubach, F. 2019. Ecological specificity of the metagenome in a set of lower termite species supports contribution of the microbiome to adaptation of the host. Animal Microbiome 1(1): 13.

34.

Yan, T.R., Lin, C.L. 1997. Purification and characterization of a glucose-tolerant β-glucosidase from Aspergillus niger CCRC 31494. Bioscience, Biotechnology, and Biochemistry 61(6): 965-970.

35.

Zhou, J., Zhang, R., Shi, P., Huang, H., Meng, K., Yuan, T., Yang, P., Yao, B. 2011. A novel low-temperature-active β-glucosidase from symbiotic Serratia sp. TN49 reveals four essential positions for substrate accommodation. Applied Microbiology and Biotechnology 92(2): 305-315.

Website Renewal Notice


Our website has recently been renewed.

In some cases, images, CSS files, or other settings saved in your browser from previous visits may be reused instead of downloading the latest files. As a result, some pages may temporarily appear incorrectly or may not display properly.

If this occurs, please perform a hard refresh.

 - Windows: Ctrl + F5
 - Mac: Command + Shift + R

If you encounter any errors or difficulties while using the website, please contact us at info@guhmok.com.

Thank you.


I don't want to open this window for a day.